According to the published sequence of 14 avian Pasteurella multocida genes required for survival and expression in vivo, the swine P. multocida infected models in septicemic mice were established and 14 pairs of primers were designed and synthesized to amplify the corresponding gene of swine P. multocida CVCC 432 strain. Successfully, two genes, pm0221 and pm1069 were identified as in vivo-expression gene using RT-PCR. Their nucleotide sequences were compared with those of avian P. multocida pm70 strain and the homology were 98.8 and 94.8%, respectively.
INTRODUCTION
Pasteurella multocida (P. multocida) is an important pathogen hazardous to aniaml and human beings with world wide distribution. Certain serotypes are the etiologic agents of severe types of pasteurellosis, such as fowl cholera in avian species, hemorrhagic septicemia in cattle and buffalo and atrophic rhinitis in swine. Despite considerable research into the mechanisms of immunity, virulence and pathogenesis, safe and effective vaccines against pasteurellosis are still lacking and little is known of the molecular mechanisms of pathogenesis. Based on the difference of capsule, 5 capsule serogroups were recognized. Based on the difference of somatic antigens, 12 somatic types were recognized (1~12). Based on the difference of Heat Stable (HS) antigen, 16 HS serogroup were recognized (1~16) (Yang, 2007). As there are different P. multocida serotypes, although it has been demonstrated that natural infection with one serotype can lead to good immunological protection against multiple serotypes and that cross-protection can also be stimulated by using inactivated bacteria grown in vivo, but traditional killed whole cell bacterins normally provide only serotype-specific protection, so immune failure were common found in pig industry, causing severe economic failure.
Since 2001, in vivo Expression Technology (IVET) (Hunt et al., 2001), Signature-Tagged Mutagenesis (STM) (Fuller, 2000; Harper et al., 2003) and DNA microarray methods (Boyce et al., 2002) were developed to identify the in vivo expression gene of P. multocida of poultry and cattle origin and Numerous genes, such as those encoding outermembrane lipoproteins, metabolic and biosynthetic enzymes and a number of hypothetical proteins, were identied. Although, these method were prove to be useful targets for attenuating mutation and/or warrant further investigation for their roles in immunity and/or pathogenesis, but study on the in vivo-expressed gene of swine P. multocida have not reported now.
In order to investigate whether there are differences in in vivo-expression pattern between avian P. multocida and swine P. multocida, 14 published in vivo-expression genes of avian P. multocida Pm70 strain were selected as reference gene and RT-PCR technology were used to select the in vivo-expression gene of swine P. multocida strain using a mouse infection model. The result may form the basis for producing recombinant antigens to establish an indirect ELISA for discriminating infection and inactivated vaccine immunized pigs.
MATERIALS AND METHODS
Bacterial strains, vectors and grown conditions: Escherichia coli strains DH5a (invitrogen) were used for cloning. Swine P. multocida strain CVCC (432) was purchased from china institute of veterinary drug control.
pMD18-T (Takara) is a high efficence T-cloning vector. E. coli was grown at 37°C in Luria-Bertani broth or on Luria-Bertani broth agar supplemented, when necessary with ampicillin (50 μg mL-1) for selection and maintenance of recombinant plasmids and additionally with 125 μM X-Gal for blue-white selection with pMD18-T. The swine P. multocida was cultured at 37°C on blood nutrient agar or brain heart infusion broth (BHI; Oxoid).
Primers: According to the 14 published in vivo-expressed genes sequence of avian P. multocida Pm70 strain (genBank AE004439), computer software Primer Premier (Version 5.0, PREMIER Biosoft International, 3786 Cornia Way, Palo Alto, CA 94303-4504) was used to design 14 paires of primers (Table 1). The oligonucleotides were synthesized by shanghai shenggong bioengineering company.
RNA isolation (Boyce et al., 2002): For the isolation of in vitro-grown P. multocida, P. multocida were harvested from duplicate BHI cultures at late log phase (5x109 CFU mL-1), added to 0.1 volume of ice-cold killing buffer (0.05 M Tris-HCl (pH7.5), 15 mg of sodium azide mL-1) and pelleted by centrifugation at 6000 g. RNA was isolated from P. multocida by using Trizol reagent (Tiangen Beijing co.limited) as described by the manufacturer. Purified RNA was treated with Dnase (15 U for 10 min at 37°C) and the RNA was further purified on Rneasy minicolumns (Qiagen). For the isolation of in vivo-grown bacteria, 5 mice (Kunming genus from experimental animal center of Sichuan university, chengdu) were infected with 5x104 CFU of P. multocida strain by injection into the leg muscle. About 0.5 g Liver was recovered from asphyxia death mouse during the final stages of disease (about 15 h after infection), Clinical signs at the time of sampling indicated that each infection was in the terminal phase. The Liver was levigated and 2 ml PBS was added into the sample. Then 0.1 volume of ice-cold killing buffer were added into 0.8 mL mixture and the bacteria were separated from the liver cells by sucrose density centrifugation for 1 h at 3,000 g in the presence of 25% (wt vol-1) sucrose. Bacteria were removed from above the sucrose cushion and concentrated by centrifugation for 5 min at 6000 g. All manipulations were carried out on ice or at 4°C and took less than 1.5 h. RNA was purified as described above for in vitro-grown bacteria.
RT-PCR
RT reaction: A total reaction volume of 20 μL was used, including 10 μL of the extracted RNA, 2 μL (25pmol μL-1) of the random primer, 4 μL of 5xRT buffer, 2 μL of dNTP (10 mM of each nucleotide), 0.5 μL of RNA inhibitor, 0.5 μL of RT intensifier and 1 μL of RTase, mix. The reaction conditions were 30°C for 10 min, 42°C for 40 min, 98°C for 5 min and 4°C for 5 min, following which the RT products (cDNA) were collected.
PCR reaction: Amplification of the cDNA was performed using 2xPCR mix 10 μL, Forward primer 0.5 μL, Reverse primer 0.5 μL, RT products 1 μL, 8 μL water, comprising a total volume of 20 μL. The optimum conditions for PCR were established according to the Tm value of primers and amplification length of target genes. Then 5 μL of each PCR product was analyzed in 0.9% agarose (BIO RAD) in TAE buffer gel containing 0.5 mg mL-1 ethidium bromide. The gels were electrophoresed at 80 V and the DNA bands were visualized and photographed using an imaging system (Versa Doc-manufactured by BIO RAD). The PCR product was sequenced by TaKaRa Dalian, China.
Cloning and seqencing of complete Open Reading Frame (ORF) of in vivo-expressed gene: According to the published in-vivo expressed genes of avian P. multocida, Primer 5.0 was used to design two paires of primers. The primers for the amplification of Pm0221 gene were Pm0221F (AACGAATGGGGCTATCCTACA) and Pm0221D (GGCGA ATAGGACGATTAGGTTG), The primers for the amplification of Pm1069 gene were Pm1069F (TATCTGACTGGTCTGAACTCTTG) and Pm1069D (CATAAAGGTTCGC ACTGG CT).
| Table 1: | Primers used for RT-PCR of swine P. multocida in vivo-expressed gene |
![]() |
|
The designed amplification length of Pm0221 and Pm1069 were 2104 and 1395 bp, respectively. The oligonucleotides were synthesized by shanghai shenggong bioengineering company. Amplification of ORF of swine P. multocida in vivo-expressed gene was performed using 2xPCR mix 25 μL, Forward primer 1 μL, Reverse primer 1 μL, RT products 2 μL, 21 μL water, comprising a total volume of 50 μL. The optimum conditions for PCR were as follows: 94°C for 4 min, 14 cycles at 94°C for 30 sec, 61°C for 30 s (a decrease of 0.5°C for every cycle), 72°C for 50 sec, 25 cycles at 94°C for 30 sec, 54°C for 30 sec, 72°C for 50 sec and final elongation at 72°C for 10 min.
Products of PCR reactions, corresponding to the predicted size of the target gene, were isolated from agarose gels and cloned into the pMD18-T plasmid to yield recombinant plasmid. Confirmation of clones containing recombinant plasmid was achieved by PCR. The recombinant plasmid was sequenced by Sangon (China).
Bioinformatics analysis of identified swine P. multocida in vivo-expressed gene: The secondary structure, hydrophobicity and surface antigen of target protein were analyzed by utilizing the protean program in the Lasergene package (DNASTAR Inc., Madison, WI 53715, USA), theprediction of protein transmembrane domain was completed online http://www.ch.embnet.org/software/TMPRED.form.html, the prediction of antigenic determinant were analyzied online http://immunax.dfci.harvard.edu/Tools/antigenic.pl.
RESULTS
Analysis of in vivo-expressed gene by RT-PCR: To analyze the in vivo-expressed gene of swine P. multocida during growth within a natural host, we used mouse as the infection model. Fourteen genes, which were in vivo-expressed gene in avian P. multocida were analyzed to see where they were in vivo-expressed gene in swine P. multocida. The results of RT-PCR shows that pm0221 and pm1069 were in vivo expressed gene of swine P. multocida (Table 2 and Fig. 1).
Cloning and sequencing of ORF of pm0221 and pm1069: Fragments of 2104 and 1395 bp length long were successflly amplified, which conformed to the designed length (Fig. 2).
| Table 2: |
The identification results of swine P. multocida in vivo-expressed gene by RT-PCR |
![]() |
|
|
A+”represent positive results of RT-PCR; “-” represent negative results of RT-PCR |
|
![]() |
|
| Fig. 1: |
The partial identification result of swine P. multocida in vivo-expressed gene by RT-PCR. Lane 1 and 2 corresponds to RT-PCR result of PM0221 gene in vivo and in vitro, respectively; while Lane 3 and 4 corresponds to RT-PCR result of PM1069 gene in vivo and in vitro, respectively. M refers to DNA Marker DL2000 |
The ORF of pm0221 gene of swine P. multocida is 1761 bp long, the same size with that of avian P. multocida, the percentige of identidy of swine swine P. multocida pm0221 gene with that of avian P. multocida is 98.8%. The OFR of pm1069 gene of swine P. multocida is 1332 bp long, 12 bp shorter than that of avian P. multocida, the percentige of identidy of swine swine P. multocida pm1069 gene with that of avian P. multocida is 94.8%. The sequence data have been submitted to the GenBank databases under accession No. GQ339604 (pm1069) and GQ339605 (pm0221), respectively.
Bioinformatics analysis: The result of deduced amino acid sequence analysis by utilyzing DNASTAR shows that the hydrophobic region and surface antigen of pm0221 protein were mainly located at 31-227 and 426-582 aa.
![]() |
|
| Fig. 2: |
The RT-PCR result of sequences containing the complete Open Reading Frame (ORF) of pm0221 and pm1069 genes of swine P. multocida. Lane 1 and 2 correspond to RT-PCR result of pm0221 and pm1069 genes, respectively. M refers to DNA Marker DL2000 |
While those of pm1069 protein were mainly located at 142-431 aa. The prediction resultes of protein transmembrane domain completed online http://www.ch.embnet.org/software/TMPRED.form.html shows that pm0221 protein have 9 transmembrane domains, mainly located at 188-446 aa, while Pm1069 protein has only one transmembrane domain, mainly located at 26-44 aa.
The prediction resultes of antigenic determinant completed online http://immunax.dfci.harvard.edu/Tools/antigenic.pl results showed that pm0221 have 19 antigenic determinants, located at 4-574 aa, while pm1069 have 15 antigenic determinants, located at 22-434 aa.
DISCUSSION
A number of screening methods have been used previously to identify potential in vivo-expressed genes in P. multocida, including STM (Fuller, 2000; Harper et al., 2003), IVET (Hunt et al., 2001) and microarray (Boyce et al., 2002). Signature-Tagged Mutagenesis (STM) was first used to identify the P. multocida virulence genes in mouse or chicken model. In vivo-Expression Technology (IVET) was utilized to identify in vivo-expressed genes of P. multocida. Numerous genes, such as those encoding outer membrane lipoproteins, metabolic and biosynthetic. enzymes and a number of hypothetical proteins, were identified. DNA microarray Methods was also used to make a genomic scale analysis of Pasteurella multocida gene expression during growth within the natural chicken host. The results of different method were different, many genes were identified in one study but not by other methods, indicating that neither of these methods produces a saturation coverage of the genome. One of the clear benefits of whole-genome expression profiling with microarrays is the ability to analyze the gene expression profiles of every gene under the conditions being tested. However, some genes were identified by STM and IVET methods that were not identified by DNA microarray Methods. This is not surprising, as STM and IVET analyses were carried out on different P. multocida strains and both used mouse infection models. Thus, infection model is significantly important.
Based on the published in vivo-expression gene identified by other method, RT-PCR were used to identify the in vivo-expressed gene of swine P. multocida in mice model. Only two genes pm0221 and pm1069 were identified as in vivo-expressed gene, while others were not in vivo-expressed gene, this results maybe related to the different strain of P. multocida and use of mouse infection model and identification method used in this study.
The homologue of avian P. multocida pm1069 were the E. coli protein FadL and the P1 outer membrane protein (Munson and Hunt, 1989) from H. influenzae. In E. coli, FadL was identified as an outer membrane porin required for the uptake of long-chain fatty acids, mutants lacking FadL are unable to grow on medium containing long-chain fatty acids as a sole carbon source (Nunn and Simons, 1978). The H. influenzae homologue P1 has been considered a potential vaccine candidate for both type b and nontypeable strains of H. influenzae, as both polyclonal and monoclonal antibodies raised against P1 protect against bacteremia in the infant rat model (Hansen et al., 1982; Loeb, 1987). The pm1069 gene of swine P. multocida CVCC432 strain is 12 bp shorter than that of avian P. multocida Pm70 strain, but the nucleotide acid sequence identidy is still high (94.8%), this 12 bp deletion maybe related to the host specificity of Pasteurella multocida and phylogenetic analysis of pm1069 gene with more strains of swine and avian P. multocida should be undertaken.
The avian P. multocida pm0221 gene encoding DsbD protein (Hunt et al., 2001). In E. coli, DsbD is a integral membrane protein involved in disulfide bond formation in periplasmic proteins (Missiakas et al., 1995). As disulfide bonds are often essential for the proper folding, stability and activity of many extracellular proteins, the expression of such a gene in vivo may have implications in bacterial pathogenesis for the secretion of toxins or other virulence factors. Additionally, DsbD is required for c-type cytochrome biogenesis under anaerobic conditions and plays a role in copper (Cu2+) tolerance in bacteria such as E. coli, S. enterica serovar Typhimurium and P. aeruginosa (Crooke and Cole, 1995; Gupta et al., 1997; Page et al., 1997).
ACKNOWLEDGEMENTS
The research was financially supported by Sichuan Agricultural University Science and Technology Innovation Foundation (Grant No: 17) and Program for Changjiang Scholars and Innovative Research Team in University PCSIRT (Grant No: IRTO848).
Xintian Wen, Nianli Zou, Sanjie Cao, Yong Huang, Mingxing Tian and Xianqi Huang. Identification and Sequencing of Two Expression Genes of Porcine Pasteurella multocida in vivo.
DOI: https://doi.org/10.36478/javaa.2010.441.445
URL: https://www.makhillpublications.co/view-article/1680-5593/javaa.2010.441.445