Genetic diversity being the basis of animal breeding forms the bedrock of animal improvement. The IGF‐1 gene is involved in the developmental and reproductive abilities of poultry and other animals. Its potential as a molecular marker was thus assessed. Local chicken strains‐normal feathered, frizzle feathered and naked neck‐were used in this study to evaluate the diversity of insulin like growth factor‐1 (IGF‐1) gene sequence. A total of sixty (60) chickens (twenty (20) from each strain, from which fifteen (15)‐five (5) was sampled per strain for blood collection and DNA extraction) were involved in the work. Jena Bioscience Gmbh preparation kit was used in extracting DNA, while the Shine Gene Primers given by: GTCGGGCTACTTGAGTTACTAC‐Forward. TTGCGCAGGCTCTASTCTGCTC‐Reverse. was used to identify genomic DNA for sequencing of the gene (IGF‐1). 2% agarose gel was used to assess the DNA purity. Results showed diversity in the amino acid composition as well as the chemical and physical properties of the IGF‐1 gene in these strains thus pointing to its stability and thus ability to withstand mutation. Thus, making IGF‐1 a marker of interest in the genomic selection of chicken for development and improvement.
L.J. Isaac, B. Okon, L. Ibom and A. Dauda. Genetic Diversity in the IGF‐1 Gene Sequence of Three Local Chicken Strains.
DOI: https://doi.org/10.36478/makjava.2025.1.6
URL: https://www.makhillpublications.co/view-article/1680-5593/makjava.2025.1.6