files/journal/2022-09-02_12-30-09-000000_653.png

Journal of Animal and Veterinary Advances

ISSN: Online 1993-601X
ISSN: Print 1680-5593
289
Views
0
Downloads

Associations of Growth Hormone Gene Polymorphisms with Milk Production Traits in South Anatolian and East Anatolian Red Cattle

Hasret Yardibi , Gulhan Turkay Hosturk , Ipek Paya , Ferhan Kaygisiz , Gurhan Ciftioglu , Ahmet Mengi and Kemal Oztabak
Page: 1040-1044 | Received 21 Sep 2022, Published online: 21 Sep 2022

Full Text Reference XML File PDF File

Abstract

The current study was undertaken to determine the relationship between milk production traits of Eastern Anatolian Red (EAR) and South Anatolian Red (SAR) breed cows and polymorphisms of Growth Hormone gene (GH) which is a potentially effective Quantitative Trait Loci (QTL) on milk production traits. Fifty cows that were newly delivered calves from each of EAR and SAR breeds were used. Triplicate milk samples were obtained between 0-30, 50-180 and 270-300 days of lactation period. Milk samples were analyzed for milk fat, protein, dry substance, refraction indices and somatic cell count. In addition, DNA samples were obtained from blood samples of each cow and AluI and MspI polymorphisms in GH were determined using PCR-RFLP method. In both breeds, AluI polymorphism with VV genotype cows had higher milk fat percentage compared to other genotypes. Similarly, in SAR cows, those with MspI polymorphism and -/- genotype had higher milk fat percentage compared to other genotypes. The relationship between GH gene polymorphisms and other milk quality parameters could not be established. As a result, it can be concluded that GH gene polymorphisms can be of a valuable parameter to be used for selection of EAR and SAR cows for improving milk fat percentage.


INTRODUCTION

Up to date, a number of Quantitative Trait Loci (QTL), which were found effective on milk production traits were determined in cows as a result of genome screening studies . The objective of a cattle breeding program is to determine the gene sets that positively affect production traits and to improve phenotypic structures by means of transferring these gene sets to the next generations. These studies focused particularly on milk production traits (Ashwell et al., 2004; Schrooten et al., 2000).

Growth Hormone gene (GH) has been widely studied in livestock because of its effects on important biological functions including growth, body composition and development of mammary cell, lactogenesis and proliferation of mammary cells (Horvat and Medrano, 1995; Nielsen et al., 1995; Lagziel et al., 1999). GH gene of cattle is approximately 1800 bp in size and contains 5 exons and 4 introns. This gene encodes a mRNA in the size of 786 bp (Woychik et al., 1982). GH is located on 19th chromosome in q26-qter band region (Hediger et al., 1990).

Although, a number of polymorphisms were determined in GH gene of cattle up to date, 2 polymorphisms located in the intron 3 and exon 5 were found significant for their effects on milk and meat yield parameters by RFLP (Hoej et al., 1993; Lucy et al., 1991). The polymorphisms which is digested by MspI restriction enzyme is located on the intron 3 (Zhang et al., 1993a). As a result of digestion with this enzyme, 2 alleles occur and MspI (-) contains a T-insertion at +837 position and a C-G transition at +837 position (Lee et al., 1994a). Zhang et al. (1993b) reported that the polymorphism in the exon 5 could be digested by AluI enzyme and 2 alleles as L and V occur. As a result of this polymorphism, leucine amino acid in the codone 127 of GH is converted to valine.

In the present study, it was aimed to investigate the relationship between polymorphisms of GH gene and milk production traits of EAR and SAR cows, 2 of the native cattle breeds of Turkey and to evaluate the use of these polymorphisms as a selection marker in these cattle breeds.

MATERIALS AND METHODS

Animal material: In the present study, 50 dairy cows from each of EAR and SAR breeds were used. A questionnaire carried out with animal owners were used for selection of the cows. Those cows that are not relatives of each other and are exposed to similar environmental conditions and nutritional regime, are healthy and within the 0-30 days of lactation period were selected.

Milk samples and analysis: Triplicate milk samples were collected from the cows at the beginning (0-30 days), middle (150-180 days) and at the end (270-300 days) of lactation. The samples were analyzed for milk fat, solids non-fat and protein levels using a rapid milk analyzer (EKOMILK milk analyzer, EON Trading LLC, USA). Somatic cell count was determined using somatic cell counter (firefly, Charm Sciences Inc, USA) and commercial test kits. Refraction indices of milk fat were determined by a hand refractometer at the time of sample collection.

DNA isolation: Blood samples were collected in sterile 2 mL tubes containing EDTA. Genomic DNAs were isolated using a standard salt-out method (Miller et al., 1998).

PCR-RFLP analysis: The PCR for AluI and MspI polymorphisms were carried out in a final volume of 25 μL containing 1 U Taq DNA polymerase (Fermentas Life Sciences, Canada), 2-2.5 μL 10XPCR buffer (750 mM Tris HCl (pH 8.0), 200 mM (NH4)2SO4,0.1% Tween 20), 1.5 mM MgCl2, 50-100 ng genomic DNA, 100 μM dNTP (Takara, Biotechnology Co, Ltd, Japan) and 10 pmol of each primer. The Primer sequence used for the GH AluI site: Primer forward: 5 GCTGCTCCTGAGGGCCCTTCG 3 and Primer reverse: 5GCGGCGGCACTTCATGACCCT 3 (Mitra et al., 1995). PCR conditions were 5 min at 94°C, 60 sec at 94°C, 60 sec at 60°C, 60 sec at 72°C, 32 cycles and 10 min at 72°C. The amplified samples were subjected to digestion with 10U AluI at 37°C for 3 h. The resulting products were loaded to 3-5% Nusieve GTG agarose gel within 1X TBE and then run at 120 V for 40 min for separation of the DNA fragments. The bands were stained with ethidium bromide prior to visualization by UV light. The Primer sequence used for the GH MspI site: Primer forward: 5´AGAATGAGGCCCAGCAGAAATC 3´ and Primer reverse: 5´GTCGTCACTGCGCATGTTTG 3´ PCR conditions were 2 min 15 sec at 94°C, 45 sec at 94°C for 5 min, 60 sec at 58°C, 60 sec at 72°C, 33 cycles and 5 min at 72°C. The amplified bands were subjected to 5 U MspI at 37 °C for 16 h. The resulting products were loaded to 3-5% Nusieve GTG agarose gel within 1X TBE and then run at 120 V for 30 min for separation of the DNA fragments. The bands were stained with ethidium bromide and visualized under UV light.

Statistical analysis: Distribution of GH genotype and alleles in EAR and SAR and chi-square (χ2) test to indicate the populations were in Hardy-Weinberg equilibrium were evaluated by using PopGene32 software (Yeh et al., 2000). The differences in milk protein, fat, dry substance, somatic cell count and refraction indices genotypes in both races were compared by using General Linear Model (GLM) (SPSS, version 11.5). The results are reported as mean±Standard Error (SE).

RESULTS

Detection of PCR-RFLP polymorphism: As a result of digestion of 223 bp target region on GH gene exon 5 by AluI enzyme, the samples with 223 bp fragment (uncut) were accepted as VV genotype, those with 223, 171 and 52 bp fragments as VL and those with 171 and 52 bp were evaluated as LL genotypes. As a results of the 768 bp target region on intron 3 of GH gene by MspI enzyme, the samples with 612, 93 and 63 bp fragments were accepted as Msp(+/+) genotype, those with 705, 612, 93 and 63 bp fragments were Msp(+/-) genotype and those with 705, 93 and 63 bp fragments were evaluated as Msp(-/-) genotypes.

Distribution of genotypes and alleles of GH AluI and MspI polymorphisms of EAR and SAR cows are provided in Table 1. In SAR cows, L allele frequency for AluI polymorphism was found higher than V allele frequency. On the other hand, in EAR cows, the frequency of V alleles was higher than L alleles. As for the MspI polymorphisms, Msp+ allele frequency was appreciably higher than Msp - allele frequency in both cattle breeds.

Milk production traits: Distribution of milk production traits by GH AluI and MspI polymorphism genotypes for EAR and SAR cows are given in Table 2 and 3, respectively. In both breeds, it was found that LL genotype of AluI polymorphism has significantly higher fat level compared to VV genotypes (p<0.05). Similarly, Msp(-/-) genotype of MspI polymorphism of SAR cows had significantly higher milk fat compared to Msp(+/+) genotypes (p<0.05). In EAR cows, however, no animal was detected as Msp(-/-) genotype. For other milk traits, no significant difference between the genotypes of these 2 polymorphisms was detected.

Table 1: Distribution of GH AluI and MspI polymorphisms genotypes and allele frequencies in South Anatolian and East Anatolian Red cattle
1South anatolian red cattle, 2East anatolian red cattle

 

Table 2: Least square means (±SE) of milk production traits in South Anatolian and East Anatolian Red cattle breeds with different GH AluI genotypes
1South Anatolian red cattle, 2East Anatolian red cattle, 3Protein, 4Solids non fat, 5Refraction indices, 6Somatic cell score, a,bMeans within the same line with different letters differ (p<0.05)

 

 

Table 3: Least square means (±SE) of milk production traits in South Anatolian and East Anatolian Red cattle breeds with different GH MspI genotypes
1South Anatolian red cattle, 2East Anatolian red cattle, 3Protein, 4Solids non fat, 5Refraction indices, 6Somatis cell score, abMeans within the same line with different letters differ (p<0.05)

 

DISCUSSION

Turkey is appreciably rich in cattle population where as quiete poor in terms of yield per animal. It is generally accepted that causes of poor yield of animals are poor environmental conditions, poor nutritional regimes as well as low capacity genotypes. However, it is clear that there is almost no published study on known potential QTLs of EAR and SAR breed cattle. SAR cattle are commonly raised in Southern Anatolia in Turkey. In addition, different varieties of this breed can be found in Syria, Israel and Egypt. Annual milk yield of SAR varies between 1000 and 1500 kg. It has been reported that annual milk yield could be as high as 5000 kg when the environmental and nutritional conditions were improved. EAR breed cattle are common in Eastern Anatolia. Annual milk yield of this breed varies between 1000 and 1200 kg. Both of these breeds are known for their ability to their adaptation to poor environmental and nutritional conditio. Milk production traits of cows are controlled by many genes as well as influenced by environmental conditions. In recent years, a number of candidate genes affecting milk production genes has been found and many studies has been undertaken investigating the relationship between these candidate genes and lactation performance of cows (Dybus et al., 2004).

Growth hormone is a potential Quantitative Traits Loci (QTL) affecting the milk production traits. Sabour et al. (1997) reported for Holstein cows that GH gene AluI polymorphism V allele genotypes had better milk traits, especially higher milk protein, compared to the other genotypes. In contrast Chung et al. (1996) reported that cows with LL genotype had higher milk protein level. Likewise, Dybus (2002a) reported that LL genotype cows had higher milk yield and milk protein. In addition, GH release in L genotype German Black-White cows was reported to be higher than V genotypes (Lucy et al., 1991). In the present study, LL homozygote EAR and SAR cows had significantly higher milk fat level compared to the other genotypes. Although this finding was in agreement with those reported by Dybus (2002b) regarding milk fat level, no positive relation was found between milk protein and genotypes. Hoej et al. (1993) and Lee et al. (1994a) reported that milk fat level of GH MspI (-) genotype animals was higher. Lagziel et al. (1999) reported that milk protein content was higher in heterozygote animals while Dybus et al. (2002) reported milk fat levels was higher in Msp (+ / +) homozygote animals. Unlike these findings, Yao et al. (1996) reported that GH MspI (+) allele positively affected milk yield, protein and fat in cows. In the current study, similar to the findings reported by these researchers, milk fat level of Msp(-/-) genotype SAR cows was significantly higher than that of the other genotypes. MspI(-) allele frequency is usually found at low level in high yield northen European/USA and eastren European/Mediterranean cattle breeds (0.10-0.39, respectively) where as found at higher frequency in zebu cattle breeds (0.87) (Hoej et al., 1993; Dybus, 2002b; Lagziel et al., 2000). In the study, Msp(-) allel ferequancy was detected 0.33 and 0.41 in SAR and EAR cattle breeds, respectively.

CONCLUSION

As a result, we can conclude that GH gene AluI polymorphism VV genotype positively affect milk fat percentage in EAR and SAR cattle. The MspI polymorphism Msp(-/-) genotype also positively affect milk fat percentage in SAR. Our findings on GH gene polymorphisms can be used in as selection markers for improving the milk fat level in both Turkish native cattle breeds.

How to cite this article:

Hasret Yardibi , Gulhan Turkay Hosturk , Ipek Paya , Ferhan Kaygisiz , Gurhan Ciftioglu , Ahmet Mengi and Kemal Oztabak . Associations of Growth Hormone Gene Polymorphisms with Milk Production Traits in South Anatolian and East Anatolian Red Cattle.
DOI: https://doi.org/10.36478/javaa.2009.1040.1044
URL: https://www.makhillpublications.co/view-article/1680-5593/javaa.2009.1040.1044