TY  - JOUR
T1  - Genetic Diversity in the IGF‐1 Gene Sequence of Three Local Chicken Strains
AU - Isaac, L.J. AU - Okon, B. AU - Ibom, L. AU - Dauda, A. 
JO  - Journal of Animal and Veterinary Advances
VL  - 24
IS  - 1
SP  - 1
EP  - 6
PY  - 2025
DA  - 2001/08/19
SN  - 1680-5593
DO  - makjava.2025.1.6
UR  - https://makhillpublications.co/view-article.php?doi=makjava.2025.1.6
KW  - Genetic diversity
KW  - sequence
KW  - local chickens
KW  - strains
KW  - gene
AB  - Genetic diversity being the basis of animal breeding forms the bedrock of
animal improvement. The IGF‐1 gene is involved in the developmental
and reproductive abilities of poultry and other animals. Its potential as a
molecular marker was thus assessed. Local chicken strains‐normal
feathered, frizzle feathered and naked neck‐were used in this study to
evaluate the diversity of insulin like growth factor‐1 (IGF‐1) gene
sequence. A total of sixty (60) chickens (twenty (20) from each strain,
from which fifteen (15)‐five (5) was sampled per strain for blood
collection and DNA extraction) were involved in the work. Jena Bioscience
Gmbh preparation kit was used in extracting DNA, while the Shine Gene
Primers given by: GTCGGGCTACTTGAGTTACTAC‐Forward.
TTGCGCAGGCTCTASTCTGCTC‐Reverse. was used to identify genomic DNA
for sequencing of the gene (IGF‐1). 2% agarose gel was used to assess the
DNA purity. Results showed diversity in the amino acid composition as
well as the chemical and physical properties of the IGF‐1 gene in these
strains thus pointing to its stability and thus ability to withstand mutation.
Thus, making IGF‐1 a marker of interest in the genomic selection of
chicken for development and improvement.
ER  - 